Short
Communication
Evaluation of EGFR, KRAS
and BRAF gene mutations in renal cell carcinoma
Omer Bayrak1,
Haluk Sen1, Ersan Bulut1, Beyhan Cengiz2,3,
Metin Karakok4, Sakip Erturhan1, Ilker Seckiner1
1Department of Urology, 3Department of Physiology, 4Department of Pathology, University of Gaziantep, Gaziantep, Turkey; 2Department of Medical Genetics, University of Gazi, Ankara, Turkey
Abstract
A
subset of renal cell carcinoma (RCC) patients has been shown to respond to
anti-EGFR therapy. As KRAS and BRAF mutations are associated with poor response
to anti-EGFR therapy in some cancers, it has been suggested that screening for
KRAS and BRAF mutations in RCC may be a promising strategy to identify patients
who might respond to EGFR-targeted therapy. The aim of this study was to
investigate the mutation status of EGFR, KRAS and BRAF in RCC patients. Renal
tumors and normal renal samples from forty-eight patients who underwent radical
or partial nephrectomy for kidney cancer were used in this study. Histological
classification of the tumors was performed according to International Union
against Cancer (UICC) / American Joint Committee on Cancer (AJCC) classification.
Seventeen patients (48%) had clear-cell RCC, 7 (20%) had chromophobe RCC, and
11 patients (32%) had papillary RCC. DNA isolated from the samples was
subjected to melting curve mutation analysis for EGFR, BRAF and KRAS using
ABI-3130 DNA sequencer. DNA sequencing analysis of RCC samples, when compared
with morphologically normal matched regions, did not show any exon mutations.
Our results do not support the notion that EGFR, KRAS and BRAF might be mutated
in RCC. Copyright: The Authors.
Received: 04 June 2014; Accepted after revision: 31 July 2014;
Published: 05 August 2014
Author
for correspondence: Assistant Professor Omer Bayrak, University of Gaziantep,
School of Medicine, Department of Urology, 27310, Gaziantep, Turkey. E-mail: [email protected]
How
to cite: Bayrak O, Sen H, Bulut
E, Cengiz B, Karakok M, Erturhan S,, Seckiner I. Evaluation
of EGFR, KRAS and BRAF gene mutations in renal cell carcinoma. Journal of
Kidney Cancer and VHL 2014; 1(4):40-45.
Renal cell carcinoma (RCC) constitutes
3% of all adult malignancies (1). According to Surveillance, Epidemiology, and
End Results (SEER) data, the annual increase in RCC incidence is 2.5-3%, as we
have started to use modern imaging methods more frequently since 1970s (2). Although 60% of new diagnoses are
coincidental, 25% of the patients are metastatic during the diagnosis (3).
Radical nephrectomy or nephron sparing surgery is the standard treatment for
localized RCC, while 30% of the patients experience recurrence after the
surgery (3). Despite the tremendous improvements in our understanding of the
molecular mechanisms of RCC, and the introduction of many novel multi-tyrosine
kinase inhibitors in clinical practice for the treatment of RCC the five-year
survival of metastatic patients continues to be less than 10%. There is a need
for a better understanding of the molecular mechanisms of RCC and the discovery
of more efficient therapeutics for the management of metastatic RCC.
The epidermal growth factor receptor
(EGFR), a transmembrane tyrosine kinase receptor of the Erb family, is
overexpressed in both primary and metastatic RCC (4-6) suggesting the potential
of anti-EGFR agents as therapeutics for the treatment of RCC. While anti-EGFR
therapy demonstrated effective anti-tumoric activity in laboratory settings (7,
8), clinical trials demonstrated a very low objective response (9). Of the 88
patients treated with ABX-EGF, one complete, two partial, and two minor
responses were observed (9). While the reasons for these disappointing results
are not clear, it is possible that mutations of KRAS and BRAF are involved.
This notion stems from the fact that, in colorectal cancer, mutations of KRAS/BRAF genes, which are
integral part of the EGFR signaling pathway make EGFR inhibitors ineffective
(10, 11). On the contrary, a case report demonstrates that EGFR mutations could
sensitize patients to anti-EGFR therapy (12). Therefore, screening for EGFR,
KRAS and BRAF mutations in RCC may be a promising strategy to identify patients
who might respond to EGFR-targeted therapy.
The present study aims to identify EGFR, KRAS and BRAF mutations in RCC.
MATERIALS AND METHODS
Patient Selection
After obtaining local ethics committee
approval, RCC and matched normal samples from 48 patients who underwent radical
or partial nephrectomy for kidney cancer were evaluated between June 2009 and
June 2011 at the University of Gaziantep, Department of Urology, Turkey.
Thirteen patients who had benign and ureteral carcinoma according to the
pathological results were excluded from the study. The samples from the
remaining 35 patients were used for further study. Portion of the samples were
formalin-fixed and processed for histology and the remaining were stored at -80oC
until use.
Histology
Three micron sections of the
formalin-fixed kidney samples were stained with hematoxyline and eosine and the tumor grade was
determined according to International
Union against Cancer (UICC) / American Joint Committee on Cancer (AJCC) 2009
TNM classification, whereas tumor nuclear grading was performed according to
the Fuhrman grading system by a qualified Pathologist.
Mutation Detection
DNA from kidney samples that had been stored at -80C (30-50 mg tissue) were isolated using Roche High Pure Polymerase Chain Reaction (PCR) Template Preparation Kit (Catalogue Number: 11 796 828 001) following the protocol of the supplier. DNA samples were stored at -20C until further use. DNA sequencing was performed on an ABI 3130 DNA sequencing analysis instrument. The target area was amplified by PCR using primers specific to EGFR, KRAS, and BRAF (Table 1).
Table 1. PCR primers and product lengths of EGFR, BARF and KRAS
|
Gene |
Exon |
|
Primer sequences |
Product length (bp) |
|
EGFR |
18 |
Forward |
GTGAGGGCTGAGGTGACC |
186 |
|
Reverse |
TGTGCCAGGGACCTTACC |
|||
|
19 |
Forward |
TGCCAGTTAACGTCTTCC |
155 |
|
|
Reverse |
CACAGCAAAGCAGAAACTC |
|||
|
21 |
Forward |
TCTTCCCATGATGATCTGTC |
225 |
|
|
Reverse |
GACCTAAAGCCACCTCCT |
|||
|
BRAF |
11 |
Forward |
TGTTTGGCTTGACTTGAC |
176 |
|
Reverse |
CACCACATTACATACTTACC |
|||
|
15 |
Forward |
TACTGTTTTCCTTTACTTAC |
165 |
|
|
Reverse |
TAGCCTCAATTCTTACCA |
|||
|
KRAS |
1 |
Forward |
GGCCTGCTGAAAATGACTGA |
162 |
|
Reverse |
GTCCTGCACCAGTAATATGC |
|||
|
2 |
Forward |
CTGTAATAATCCAGACTGTG |
151 |
|
|
Reverse |
TCCCCAGTCCTCATGTACTG |
RESULTS
Nineteen male and 16 female patients (35 patients in total) who had RCC were included in the study. The mean age of the patients was calculated as 59.31+/12.52 (15-77) years. None of the patients were in an occupational group that might play a role in kidney cancer etiology. History of smoking was present in ten male patients (52.6%) and in four female patients (25%). The mean body mass index was 28.31 +/ 3.45 (21-33) kg/m2. According to histopathological UICC and AJCC classification systems, 17 patients (48%) had clear-cell RCC, 7 patients (20%) had chromophobe cell RCC, and 11 patients (32%) had papillary RCC. According to 2009 TNM staging of the tumors, 11 patients (31%) were T1a, 8 patients (23%) were T1b, 3 patients (8%) were T2, 9 patients (26%) T3a, and 4 patients (12%) T3b. Twenty-three patients (65%) were evaluated as N0, 8 were (23%) N1, and 4 patients were (12%) N2. According to the Fuhrman grading system, 3 patients (8%) were Grade 1, 15 patients (43%) were Grade 2, and 17 patients were (49%) Grade 3 (Table 2). DNA sequencing analysis of cancer samples and normal tissues did not show any exon mutations in the EGFR, BRAS, and KRAS pathway (data not shown).
Table 2. Characteristics of patient samples
RCC
subtype % Number of samples |
|
Clearcell
RCC 48%
(17/35) Papillary
RCC 32%
(11/35) Chromophobe
RCC 20%
(7/35) |
TNM T1a
31%
(11/35) T1b
23%
(8/35) T2
8%
(3/35) T3a
26%
(9/35) T3b
12% (4/35) N0
65%
(23/35) N1
23%
(8/35) N2
12%
(4/35) |
Fuhrman’s Classification Grade
1
8%
(3/35) Grade
2
43%
(15/35) Grade
3
49%
(17/35) |
DISCUSSION
Acknowledgement
This study was supported by University
of Gaziantep, Turkey.
Conflict of interest
No conflict of interest was declared by
the authors.
References
1. Jemal A, Sigel R, Ward E, Murray T, Xu J, Thun MJ.
Cancer Statistics 2007. CA Cancer J Clin 2007; 57: 43-66.
DOI: http://dx.doi.org/10.3322/canjclin.57.1.43
2. Hock LM, Lynch J, Balaji KC. Increasing incidence
of all stages of kidney cancer in the last 2 decades in the United States: An
analysis of surveillance, epidemiology and end results program data. J Urol
2002; 167: 57-60.
DOI: http://dx.doi.org/10.1016/S0022-5347(05)65382-7
3. Janzen NK, Kim HL, Figlin RA, Belldegrun AS.
Surveillance after radical or partial nephrectomy for localized renal cell
carcinoma and management of recurrent disease. Urol Clin North Am 2003; 30:
843-852.
DOI: http://dx.doi.org/10.1016/S0094-0143(03)00056-9
4. Pu YS1, Huang CY, Kuo YZ, Kang WY, Liu GY, Huang
AM, Yu HJ, Lai MK, Huang SP, Wu WJ, Chiou SJ, Hour TC. Characterization of
membranous and cytoplasmic EGFR expression in human normal renal cortex and
renal cell carcinoma. J Biomed Sci. 2009;16:82.
DOI: http://dx.doi.org/10.1186/1423-0127-16-82
5. Dorđević G, Matušan Ilijaš K, Hadžisejdić I,
Maričić A, Grahovac B, Jonjić N. EGFR protein overexpression correlates with
chromosome 7 polysomy and poor prognostic parameters in clear cell renal cell
carcinoma. J Biomed Sci. 2012; 5:19:40.
DOI: http://dx.doi.org/10.1186/1423-0127-19-40.
6. Langner C, Ratschek M, Rehak P, Schips L, Zigeuner
R.Are heterogenous results of EGFR immunoreactivity in renal cell carcinoma
related to non-standardised criteria for staining evaluation? J Clin Pathol.
2004; 57:773-5.
DOI: http://dx.doi.org/10.1136/jcp.2003.015743
7. Prewett M1, Rothman M, Waksal H, Feldman M, Bander
NH, Hicklin DJ. Mouse-human chimeric anti-epidermal growth factor receptor
antibody C225 inhibits the growth of human renal cell carcinoma xenografts in
nude mice. Clin Cancer Res. 1998; 4:2957-66. [Pubmed]
8. Weber KL1, Doucet M, Price JE, Baker C, Kim SJ,
Fidler IJ. Blockade of epidermal growth factor receptor signaling leads to
inhibition of renal cell carcinoma growth in the bone of nude mice. Cancer Res.
2003; 63:2940-7. [Pubmed]
9. Rowinsky EK, Schwartz GH, Gollob JA, Thompson JA,
Vogelzang NJ, Figlin R, Bukowski R, Haas N, Lockbaum P, Li YP, Arends R, Foon
KA, Schwab G, Dutcher J. Safety, pharmacokinetics, and activity of ABX-EGF, a
fully human anti-epidermal growth factor receptor monoclonal antibody in
patients with metastatic renal cell cancer. J Clin Oncol. 2004; 22:3003-15.
DOI: http://dx.doi.org/10.1200/JCO.2004.11.061
10. Karapetis CS, Khambata-Ford S, Jonker DJ,
O'Callaghan CJ, Tu D, Tebbutt NC, Simes RJ, Chalchal H, Shapiro JD, Robitaille
S, Price TJ, Shepherd L, Au HJ, Langer C, Moore MJ, Zalcberg JR. K-ras
mutations and benefit from cetuximab in advanced colorectal cancer. N Engl J
Med. 2008; 359:1757-65.
DOI: http://dx.doi.org/10.1056/NEJMoa0804385
11. De Roock W1, Piessevaux H, De Schutter J, Janssens
M, De Hertogh G, Personeni N, Biesmans B, Van Laethem JL, Peeters M, Humblet Y,
Van Cutsem E, Tejpar S. KRAS wild-type state predicts survival and is
associated to early radiological response in metastatic colorectal cancer
treated with cetuximab. Ann Oncol. 2008; 19:508-15.
DOI: http://dx.doi.org/10.1093/annonc/mdm496
12. Kobayashi S, Canepa HM, Bailey AS, Nakayama S,
Yamaguchi N, Goldstein MA, Huberman MS, Costa DB. Compound EGFR mutations and
response to EGFR tyrosine kinase inhibitors. J Thorac Oncol. 2013; 8:45-51.
DOI: http://dx.doi.org/10.1097/JTO.0b013e3182781e35
13. Seth R, Crook S, Ibrahem S, Fadhil W, Jackson D,
Ilyas M. Concomitant mutations and splice variants in KRAS and BRAF demonstrate
complex perturbation of the Ras/Raf signalling pathway in advanced colorectal
cancer. Gut 2009; 58: 1234-1241.
DOI: http://dx.doi.org/10.1136/gut.2008.159137
14. Pu YS, Huang CY, Kuo YZ, Kang WY, Liu GY, Huang
AM, et al. Characterization of membranous and cytoplasmic EGFR expression in
human normal renal cortex and renal cell carcinoma. J Biomed Sci 2009; 16: 82.
DOI: http://dx.doi.org/10.1186/1423-0127-16-82
15. Bellmunt J, Montagut C, Albiol S, Carles J.
Present strategies in the treatment of metastatic renal cell carcinoma: An
update on molecular targeting agents. BJU Int 2007; 99: 274-80. [Pubmed]
16. Salomon DS, Brandt R, Ciardiello F, Normanno N.
Epidermal growth factor related peptides and their receptors in human
malignancies. Crit Rev Oncol Haematol 1995; 19: 183-232. [Pubmed]
17. Kamai T, Arai K, Koga F, Abe H, Nakanishi K,
Kambara T. Higher expression of K-ras is associated with parathyroid
hormone-related protein-induced hypercalcaemia in renal cell carcinoma. BJU Int
2001; 88: 960-96.
DOI: http://dx.doi.org/10.1046/j.1464-4096.2001.01294.x
18. Kozma L, Kiss I, Nagy A, Szakall S, Ember I.
Investigation of c-myc and K-ras amplification in renal clear cell
adenocarcinoma. Cancer Lett 1997; 111: 127-131.
DOI: http://dx.doi.org/10.1016/S0304-3835(96)04527-2
19. Gattenlohner S, Etschmann B, Riedmiller H,
Muller-Hermelink HK. Lack of KRAS and BRAF mutation in renal cell carcinoma. Eur
Urol. 2009 Jun;55(6):1490-1.
DOI: http://dx.doi.org/10.1016/j.eururo.2009.02.024
20. Szymańska K, Moore LE, Rothman N, Chow WH, Waldman
F, Jaeger E, et al. TP53, EGFR, and KRAS mutations in relationt to VHL
inactivation and lifestyle risk factors in renal-cell carcinoma from Central
and Eastern Europe. Cancer Lett. 2010; 293: 92-98.
DOI: http://dx.doi.org/10.1016/j.canlet.2009.11.024
21. Sakaeda T, Okamura N, Gotoh A, Shirakawa T, Terao
S, Morioka M, Tokui K, Tanaka H, Nakamura T, Yagi M, Nishimura Y, Yokoyama M,
Okumura K. EGFR mRNA is upregulated, but somatic mutations of the gene are
hardly found in renal cell carcinoma in Japanese patients. Pharm Res. 2005;
22:1757-61.
DOI: http://dx.doi.org/10.1007/s11095-005-7094-2